Search results for the GEO ID: GSE15481  |
(Click on the check boxes provided under "Select for analysis", to initiate grouping) |
(Once the selection is made, click on "Add groups" in "Make groups for comparison", to make a group. Scroll down) |
|
GSM ID | GPL ID |
Select for analysis |
Title |
Source name |
Description |
Characteristics |
GSM388424 | GPL570 |
|
AP-2 gamma targetting siRNA 1: AAUGAGAUGGCAGCUAGGAAG Technical Replicate 1
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: AP-2 gamma targetting siRNA 1
cell line: MCF7
|
AP-2 gamma silenced
|
| Sample_geo_accession | GSM388424
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388424/suppl/GSM388424.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388425 | GPL570 |
|
AP-2 gamma targetting siRNA 1: AAUGAGAUGGCAGCUAGGAAG Technical Replicate 2
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: AP-2 gamma targetting siRNA 1
cell line: MCF7
|
AP-2 gamma silenced
|
| Sample_geo_accession | GSM388425
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388425/suppl/GSM388425.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388426 | GPL570 |
|
AP-2 gamma targetting siRNA 1: AAUGAGAUGGCAGCUAGGAAG Technical Replicate 3
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: AP-2 gamma targetting siRNA 1
cell line: MCF7
|
AP-2 gamma silenced
|
| Sample_geo_accession | GSM388426
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388426/suppl/GSM388426.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388427 | GPL570 |
|
AP-2 gamma targetting siRNA 2: GCGGCCCAGCAACUGUGUAAA Technical Replicate 1
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: AP-2 gamma targetting siRNA 2
cell line: MCF7
|
AP-2 gamma silenced
|
| Sample_geo_accession | GSM388427
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388427/suppl/GSM388427.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388428 | GPL570 |
|
AP-2 gamma targetting siRNA 2: GCGGCCCAGCAACUGUGUAAA Technical Replicate 2
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: AP-2 gamma targetting siRNA 2
cell line: MCF7
|
AP-2 gamma silenced
|
| Sample_geo_accession | GSM388428
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388428/suppl/GSM388428.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388429 | GPL570 |
|
AP-2 gamma targetting siRNA 2: GCGGCCCAGCAACUGUGUAAA Technical Replicate 3
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: AP-2 gamma targetting siRNA 2
cell line: MCF7
|
AP-2 gamma silenced
|
| Sample_geo_accession | GSM388429
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388429/suppl/GSM388429.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388430 | GPL570 |
|
AP-2 gamma targetting siRNA 3: CCACACUGGAGUCGCCGAAUA Technical Replicate 1
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: AP-2 gamma targetting siRNA 3
cell line: MCF7
|
AP-2 gamma silenced
|
| Sample_geo_accession | GSM388430
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388430/suppl/GSM388430.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388431 | GPL570 |
|
AP-2 gamma targetting siRNA 3: CCACACUGGAGUCGCCGAAUA Technical Replicate 2
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: AP-2 gamma targetting siRNA 3
cell line: MCF7
|
AP-2 gamma silenced
|
| Sample_geo_accession | GSM388431
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388431/suppl/GSM388431.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388432 | GPL570 |
|
AP-2 gamma targetting siRNA 3: CCACACUGGAGUCGCCGAAUA Technical Replicate 3
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: AP-2 gamma targetting siRNA 3
cell line: MCF7
|
AP-2 gamma silenced
|
| Sample_geo_accession | GSM388432
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388432/suppl/GSM388432.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388433 | GPL570 |
|
Non-silencing control siRNA: AAUUCUCCGAACGUGUCACGU Technical Replicate 1
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: Non-silencing control siRNA
cell line: MCF7
|
non silencing control
|
| Sample_geo_accession | GSM388433
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388433/suppl/GSM388433.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388434 | GPL570 |
|
Non-silencing control siRNA: AAUUCUCCGAACGUGUCACGU Technical Replicate 2
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: Non-silencing control siRNA
cell line: MCF7
|
non silencing control
|
| Sample_geo_accession | GSM388434
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388434/suppl/GSM388434.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388435 | GPL570 |
|
Non-silencing control siRNA: AAUUCUCCGAACGUGUCACGU Technical Replicate 3
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: Non-silencing control siRNA
cell line: MCF7
|
non silencing control
|
| Sample_geo_accession | GSM388435
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388435/suppl/GSM388435.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388436 | GPL570 |
|
Transfection Reagent Only Technical Replicate 1
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: Transfection Reagent
cell line: MCF7
|
transfection reagent only
|
| Sample_geo_accession | GSM388436
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388436/suppl/GSM388436.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388437 | GPL570 |
|
Transfection Reagent Only Technical Replicate 2
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: Transfection Reagent
cell line: MCF7
|
transfection reagent only
|
| Sample_geo_accession | GSM388437
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388437/suppl/GSM388437.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
GSM388438 | GPL570 |
|
Transfection Reagent Only Technical Replicate 3
|
siRNA treated MCF-7 breast carcinoma cell line
|
protocol: Transfection Reagent
cell line: MCF7
|
transfection reagent only
|
| Sample_geo_accession | GSM388438
| | Sample_status | Public on Dec 14 2009
| | Sample_submission_date | Mar 31 2009
| | Sample_last_update_date | Jul 23 2010
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Cells were transfected (using Oligofectamine; Invitrogen) with 25nM siRNA targetting AP-2gamma or non-silencing control siRNA or no siRNA (transfection reagent only).
| | Sample_growth_protocol_ch1 | MCF-7 cells were cultured in DMEM, 10% FCS; plus insulin (10ug/ml).
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | Total RNA was extracted using Trizol (Sigma) following the standard protocol but including a Qiagen RNAeasy Mini column (with RNAse free DNAse step) for clean up and elution.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | Total RNA (8ug) from each sample was used to prepare biotinylated target RNA, using the One Cycle Target Labelling kit (Invitrogen) according to the manufacturer’s recommendations (http://www.affymetrix.com/support/technical/manual/expression_manual.affx)
| | Sample_hyb_protocol | 15 ug of cRNA was hybridized for 16 hr at 45C to Human Genome U133 Plus 2.0 oligonucleotide arrays (as described at http://www.affymetrix.com/products/arrays/specific/hgu133plus.affx). Arrays were washed and stained using the Affymetrix Fluidics Station 450.
| | Sample_scan_protocol | Arrays were scanned using an Affymetrix GeneArray 3000 scanner. Array images were assessed by eye to confirm scanner alignment, the absence of significant bubbles or scratches, and a low background.
| | Sample_data_processing | The data were pre-processed using the “affy” package in BioConductor: “mas5” background correction, “quantiles” normalisation (Bolstad et al. 2003), “pmonly” correction and “medianpolish” summarisation. The resulting log2 scale transformed data were imported into the Genespring package (Genespring GX 7.3, Agilent Technologies) and filtered to retain the 2500 probe sets with the highest variance across all the arrays. Welch’s t-test was then applied in conjunction with a False Discovery Rate (FDR) multiple test correction to identify the most significantly regulated genes (p<0.01).
| | Sample_platform_id | GPL570
| | Sample_contact_name | Helen,C,Hurst
| | Sample_contact_email | h.c.hurst@qmul.ac.uk
| | Sample_contact_department | Centre for Tumour Biology
| | Sample_contact_institute | Institute of Cancer
| | Sample_contact_address | Charterhouse Square
| | Sample_contact_city | London
| | Sample_contact_zip/postal_code | EC1M 6BQ
| | Sample_contact_country | United Kingdom
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM388nnn/GSM388438/suppl/GSM388438.CEL.gz
| | Sample_series_id | GSE15481
| | Sample_data_row_count | 54675
| | |
|
| |
| |
Make groups for comparisons |
(2 groups will be compared at a time) |
|
| Select GSMs and click on "Add groups" |
Enter the group name here: |
|
|
|
