Result

Search results for the GEO ID: GSE24513

(Click on the check boxes provided under "Select for analysis", to initiate grouping)

(Once the selection is made, click on "Add groups" in "Make groups for comparison", to make a group. Scroll down)

GSM ID

GPL ID

Select for analysis

Title

Source name

Description

Characteristics

GSM604479

GPL339

optic nerve_P10_rep1

optic nerves, 70 P10 mouse pups

strain: C57Bl/6J age: P10 tissue: optic nerve

The microarray experiments were performed at the McGill University and Génome Québec Innovation Centre, Montréal, Canada

Sample_geo_accession	GSM604479
Sample_status	Public on May 16 2011
Sample_submission_date	Oct 04 2010
Sample_last_update_date	May 16 2011
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Mus musculus
Sample_taxid_ch1	10090
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	Optic nerves were dissected into RNAlater (Ambion) and placed at 4C overnight before being stored at –80. Each pool of optic nerves was homogenized in Trizol (Life Technologies) using a glass/glass homogenizer. Following chloroform extraction, the lysate was purified using an RNAeasy column (Qiagen). RNA quality was assessed using an Agilent Bioanalyzer.
Sample_label_ch1	biotin
Sample_label_protocol_ch1	The Affymetrix One-cycle Target Labeling protocol was used. The RNA samples were first converted to double stranded cDNA. 10 micrograms of total RNA were mixed with 100 pM of T7-(T)24 primer (Genset, 5’ GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(dT)24-3’) in a 10 µl volume. The primer-RNA mixture was denatured for 10 minutes at 70°C and then chilled on ice. First-strand cDNA synthesis was performed using 2 µL Superscript II reverse transcriptase (Invitrogen Life Technologies) in a 20-µL reaction volume containing 10 µM dithiothreitol, 500 µM each dNTP, and 1X first-strand buffer(all from Invitrogen Life Technologies) for 60 minutes at 42°C. Second-strand synthesis was performed by adding to the first strand reaction mix: 40 units DNA polymerase I,(Invitrogen Life Technologies) 10 units Escherichia coli DNA ligase, (Invitrogen Life Technologies) and 2 units RNase H (MBI Fermentas) in a final reaction volume of 150 µL containing 1X second-strand buffer (Invitrogen Life Technologies). The reaction mixture was incubated at 16°C for 2 hours. Ten units of T4 DNA polymerase(MBI Fermentas)was added and incubated at 16°C for 5 minutes followed by the addition of 10 µL of 0.5 M EDTA (Sigma). After second-strand synthesis, the cDNA was purified by phenol chloroform extraction with Phase-Lock tubes (Eppendorf). The purified cDNA was used to generate the biotinylated cRNA probe with the Bioarray High Yield RNA transcript labeling kit (Enzo diagnostics)as indicated by the supplier. The labeled cRNA was then purified using the RNeasy total RNA clean up protocol(Qiagen).
Sample_hyb_protocol	According to the Affymetrix protocol: the hybridization mixture was prepared by mixing 15 µg of the biotinylated probe cRNA with control oligonucleotide B2 (final concentration 50 pM; Affymetrix), herring sperm DNA (final concentration 0.1 mg/ml; Research Genetics), acetylated bovine serum albumin (final concentration 0.5 mg/ml; Invitrogen Life Technologies) in a final volume of 300 µL of 1X MES hybridization buffer (100 mM MES, 1 M NaCl, 20 mM EDTA, 0.01% Tween-20; all reagents from Sigma). The hybridization mixture was denatured for 10 minutes at 99°C, incubated for 5 minutes at 45°C, and spun for 5 minutes in a benchtop microcentrifuge. The microarray was warmed to room temperature and prehybridized with 200 µL of 1X hybridization buffer for 10–20 minutes at 45°C. The prehybridization solution was removed and 200 µL ofthe hybridization mix was added to the array. The array and probe fragments were incubated at 45°C overnight (16–20 hours) in a rotating oven (Affymetrix).
Sample_scan_protocol	According to the Affymetrix protocol: after hybridization, nonspecifically bound probe was removed by washing with the GeneChip Fluidics station 400 (Affymetrix). In total, 10 low-stringency washes (6x SSPE, 0.01% Tween-20, 0.005% Antifoam) and 4 high-stringency washes (100 mM MES, 0.1 M NaCl, 0.01% Tween-20, 50oC) were per- formed (all reagents from Sigma). Specifically bound probe was detected by incubating the arrays with SAPE (Molecular Probes) and scanning the chips with a Hewlett-Packard GeneArray scanner (Affymetrix).
Sample_data_processing	Robust multichip analysis method (RMA)
Sample_platform_id	GPL339
Sample_contact_name	Hana,C.,Friedman
Sample_contact_email	cheryl.friedman@mcgill.ca
Sample_contact_phone	514934193435162
Sample_contact_laboratory	Peterson Laboratory of Developmental Biology
Sample_contact_institute	McGill University
Sample_contact_address	687 Pine Ave. West
Sample_contact_city	Montreal
Sample_contact_zip/postal_code	H3A 1A1
Sample_contact_country	Canada
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM604nnn/GSM604479/suppl/GSM604479.CEL.gz
Sample_series_id	GSE24513
Sample_data_row_count	22690

GSM604480

GPL339

optic nerve_P10_rep2

optic nerves, 50 P10 mouse pups

strain: C57Bl/6J age: P10 tissue: optic nerve

The microarray experiments were performed at the McGill University and Génome Québec Innovation Centre, Montréal, Canada.

Sample_geo_accession	GSM604480
Sample_status	Public on May 16 2011
Sample_submission_date	Oct 04 2010
Sample_last_update_date	May 16 2011
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Mus musculus
Sample_taxid_ch1	10090
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	Optic nerves were dissected into RNAlater (Ambion) and placed at 4∞C overnight before being stored at –80. Each pool of optic nerves was homogenized in Trizol (Life Technologies) using a glass/glass homogenizer. Following chloroform extraction, the lysate was purified using an RNAeasy column (Qiagen). RNA quality was assessed using an Agilent Bioanalyzer.
Sample_label_ch1	biotin
Sample_label_protocol_ch1	The Affymetrix One-cycle Target Labeling protocol was used. The RNA samples were first converted to double stranded cDNA. 10 micrograms of total RNA were mixed with 100 pM of T7-(T)24 primer (Genset, 5’ GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(dT)24-3’) in a 10 µl volume. The primer-RNA mixture was denatured for 10 minutes at 70°C and then chilled on ice. First-strand cDNA synthesis was performed using 2 µL Superscript II reverse transcriptase (Invitrogen Life Technologies) in a 20-µL reaction volume containing 10 µM dithiothreitol, 500 µM each dNTP, and 1X first-strand buffer(all from Invitrogen Life Technologies) for 60 minutes at 42°C. Second-strand synthesis was performed by adding to the first strand reaction mix: 40 units DNA polymerase I,(Invitrogen Life Technologies) 10 units Escherichia coli DNA ligase, (Invitrogen Life Technologies) and 2 units RNase H (MBI Fermentas) in a final reaction volume of 150 µL containing 1X second-strand buffer (Invitrogen Life Technologies). The reaction mixture was incubated at 16°C for 2 hours. Ten units of T4 DNA polymerase(MBI Fermentas)was added and incubated at 16°C for 5 minutes followed by the addition of 10 µL of 0.5 M EDTA (Sigma). After second-strand synthesis, the cDNA was purified by phenol chloroform extraction with Phase-Lock tubes (Eppendorf). The purified cDNA was used to generate the biotinylated cRNA probe with the Bioarray High Yield RNA transcript labeling kit (Enzo diagnostics)as indicated by the supplier. The labeled cRNA was then purified using the RNeasy total RNA clean up protocol(Qiagen).
Sample_hyb_protocol	According to the Affymetrix protocol: the hybridization mixture was prepared by mixing 15 µg of the biotinylated probe cRNA with control oligonucleotide B2 (final concentration 50 pM; Affymetrix), herring sperm DNA (final concentration 0.1 mg/ml; Research Genetics), acetylated bovine serum albumin (final concentration 0.5 mg/ml; Invitrogen Life Technologies) in a final volume of 300 µL of 1X MES hybridization buffer (100 mM MES, 1 M NaCl, 20 mM EDTA, 0.01% Tween-20; all reagents from Sigma). The hybridization mixture was denatured for 10 minutes at 99°C, incubated for 5 minutes at 45°C, and spun for 5 minutes in a benchtop microcentrifuge. The microarray was warmed to room temperature and prehybridized with 200 µL of 1X hybridization buffer for 10–20 minutes at 45°C. The prehybridization solution was removed and 200 µL ofthe hybridization mix was added to the array. The array and probe fragments were incubated at 45°C overnight (16–20 hours) in a rotating oven (Affymetrix).
Sample_scan_protocol	According to the Affymetrix protocol: after hybridization, nonspecifically bound probe was removed by washing with the GeneChip Fluidics station 400 (Affymetrix). In total, 10 low-stringency washes (6x SSPE, 0.01% Tween-20, 0.005% Antifoam) and 4 high-stringency washes (100 mM MES, 0.1 M NaCl, 0.01% Tween-20, 50oC) were per- formed (all reagents from Sigma). Specifically bound probe was detected by incubating the arrays with SAPE (Molecular Probes) and scanning the chips with a Hewlett-Packard GeneArray scanner (Affymetrix).
Sample_data_processing	Robust multichip analysis method (RMA)
Sample_platform_id	GPL339
Sample_contact_name	Hana,C.,Friedman
Sample_contact_email	cheryl.friedman@mcgill.ca
Sample_contact_phone	514934193435162
Sample_contact_laboratory	Peterson Laboratory of Developmental Biology
Sample_contact_institute	McGill University
Sample_contact_address	687 Pine Ave. West
Sample_contact_city	Montreal
Sample_contact_zip/postal_code	H3A 1A1
Sample_contact_country	Canada
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM604nnn/GSM604480/suppl/GSM604480.CEL.gz
Sample_series_id	GSE24513
Sample_data_row_count	22690

GSM604481

GPL339

optic nerve_P10_rep3

optic nerves, 50 P10 mouse pups

strain: C57Bl/6J age: P10 tissue: optic nerve

The microarray experiments were performed at the McGill University and Génome Québec Innovation Centre, Montréal, Canada

Sample_geo_accession	GSM604481
Sample_status	Public on May 16 2011
Sample_submission_date	Oct 04 2010
Sample_last_update_date	May 16 2011
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Mus musculus
Sample_taxid_ch1	10090
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	Optic nerves were dissected into RNAlater (Ambion) and placed at 4∞C overnight before being stored at –80. Each pool of optic nerves was homogenized in Trizol (Life Technologies) using a glass/glass homogenizer. Following chloroform extraction, the lysate was purified using an RNAeasy column (Qiagen). RNA quality was assessed using an Agilent Bioanalyzer.
Sample_label_ch1	biotin
Sample_label_protocol_ch1	The Affymetrix One-cycle Target Labeling protocol was used. The RNA samples were first converted to double stranded cDNA. 10 micrograms of total RNA were mixed with 100 pM of T7-(T)24 primer (Genset, 5’ GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(dT)24-3’) in a 10 µl volume. The primer-RNA mixture was denatured for 10 minutes at 70°C and then chilled on ice. First-strand cDNA synthesis was performed using 2 µL Superscript II reverse transcriptase (Invitrogen Life Technologies) in a 20-µL reaction volume containing 10 µM dithiothreitol, 500 µM each dNTP, and 1X first-strand buffer(all from Invitrogen Life Technologies) for 60 minutes at 42°C. Second-strand synthesis was performed by adding to the first strand reaction mix: 40 units DNA polymerase I,(Invitrogen Life Technologies) 10 units Escherichia coli DNA ligase, (Invitrogen Life Technologies) and 2 units RNase H (MBI Fermentas) in a final reaction volume of 150 µL containing 1X second-strand buffer (Invitrogen Life Technologies). The reaction mixture was incubated at 16°C for 2 hours. Ten units of T4 DNA polymerase(MBI Fermentas)was added and incubated at 16°C for 5 minutes followed by the addition of 10 µL of 0.5 M EDTA (Sigma). After second-strand synthesis, the cDNA was purified by phenol chloroform extraction with Phase-Lock tubes (Eppendorf). The purified cDNA was used to generate the biotinylated cRNA probe with the Bioarray High Yield RNA transcript labeling kit (Enzo diagnostics)as indicated by the supplier. The labeled cRNA was then purified using the RNeasy total RNA clean up protocol(Qiagen).
Sample_hyb_protocol	According to the Affymetrix protocol: the hybridization mixture was prepared by mixing 15 µg of the biotinylated probe cRNA with control oligonucleotide B2 (final concentration 50 pM; Affymetrix), herring sperm DNA (final concentration 0.1 mg/ml; Research Genetics), acetylated bovine serum albumin (final concentration 0.5 mg/ml; Invitrogen Life Technologies) in a final volume of 300 µL of 1X MES hybridization buffer (100 mM MES, 1 M NaCl, 20 mM EDTA, 0.01% Tween-20; all reagents from Sigma). The hybridization mixture was denatured for 10 minutes at 99°C, incubated for 5 minutes at 45°C, and spun for 5 minutes in a benchtop microcentrifuge. The microarray was warmed to room temperature and prehybridized with 200 µL of 1X hybridization buffer for 10–20 minutes at 45°C. The prehybridization solution was removed and 200 µL ofthe hybridization mix was added to the array. The array and probe fragments were incubated at 45°C overnight (16–20 hours) in a rotating oven (Affymetrix).
Sample_scan_protocol	According to the Affymetrix protocol: after hybridization, nonspecifically bound probe was removed by washing with the GeneChip Fluidics station 400 (Affymetrix). In total, 10 low-stringency washes (6x SSPE, 0.01% Tween-20, 0.005% Antifoam) and 4 high-stringency washes (100 mM MES, 0.1 M NaCl, 0.01% Tween-20, 50oC) were per- formed (all reagents from Sigma). Specifically bound probe was detected by incubating the arrays with SAPE (Molecular Probes) and scanning the chips with a Hewlett-Packard GeneArray scanner (Affymetrix).
Sample_data_processing	Robust multichip analysis method (RMA)
Sample_platform_id	GPL339
Sample_contact_name	Hana,C.,Friedman
Sample_contact_email	cheryl.friedman@mcgill.ca
Sample_contact_phone	514934193435162
Sample_contact_laboratory	Peterson Laboratory of Developmental Biology
Sample_contact_institute	McGill University
Sample_contact_address	687 Pine Ave. West
Sample_contact_city	Montreal
Sample_contact_zip/postal_code	H3A 1A1
Sample_contact_country	Canada
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM604nnn/GSM604481/suppl/GSM604481.CEL.gz
Sample_series_id	GSE24513
Sample_data_row_count	22690

GSM604482

GPL339

optic nerve_P4_rep1

optic nerve, 75 at P4

strain: C57Bl/6J age: P4 tissue: optic nerve

The microarray experiments were performed at the McGill University and Génome Québec Innovation Centre, Montréal, Canada

Sample_geo_accession	GSM604482
Sample_status	Public on May 16 2011
Sample_submission_date	Oct 04 2010
Sample_last_update_date	May 16 2011
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Mus musculus
Sample_taxid_ch1	10090
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	Optic nerves were dissected into RNAlater (Ambion) and placed at 4∞C overnight before being stored at –80. Each pool of optic nerves was homogenized in Trizol (Life Technologies) using a glass/glass homogenizer. Following chloroform extraction, the lysate was purified using an RNAeasy column (Qiagen). RNA quality was assessed using an Agilent Bioanalyzer.
Sample_label_ch1	biotin
Sample_label_protocol_ch1	The Affymetrix One-cycle Target Labeling protocol was used. The RNA samples were first converted to double stranded cDNA. 10 micrograms of total RNA were mixed with 100 pM of T7-(T)24 primer (Genset, 5’ GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(dT)24-3’) in a 10 µl volume. The primer-RNA mixture was denatured for 10 minutes at 70°C and then chilled on ice. First-strand cDNA synthesis was performed using 2 µL Superscript II reverse transcriptase (Invitrogen Life Technologies) in a 20-µL reaction volume containing 10 µM dithiothreitol, 500 µM each dNTP, and 1X first-strand buffer(all from Invitrogen Life Technologies) for 60 minutes at 42°C. Second-strand synthesis was performed by adding to the first strand reaction mix: 40 units DNA polymerase I,(Invitrogen Life Technologies) 10 units Escherichia coli DNA ligase, (Invitrogen Life Technologies) and 2 units RNase H (MBI Fermentas) in a final reaction volume of 150 µL containing 1X second-strand buffer (Invitrogen Life Technologies). The reaction mixture was incubated at 16°C for 2 hours. Ten units of T4 DNA polymerase(MBI Fermentas)was added and incubated at 16°C for 5 minutes followed by the addition of 10 µL of 0.5 M EDTA (Sigma). After second-strand synthesis, the cDNA was purified by phenol chloroform extraction with Phase-Lock tubes (Eppendorf). The purified cDNA was used to generate the biotinylated cRNA probe with the Bioarray High Yield RNA transcript labeling kit (Enzo diagnostics)as indicated by the supplier. The labeled cRNA was then purified using the RNeasy total RNA clean up protocol(Qiagen).
Sample_hyb_protocol	According to the Affymetrix protocol: the hybridization mixture was prepared by mixing 15 µg of the biotinylated probe cRNA with control oligonucleotide B2 (final concentration 50 pM; Affymetrix), herring sperm DNA (final concentration 0.1 mg/ml; Research Genetics), acetylated bovine serum albumin (final concentration 0.5 mg/ml; Invitrogen Life Technologies) in a final volume of 300 µL of 1X MES hybridization buffer (100 mM MES, 1 M NaCl, 20 mM EDTA, 0.01% Tween-20; all reagents from Sigma). The hybridization mixture was denatured for 10 minutes at 99°C, incubated for 5 minutes at 45°C, and spun for 5 minutes in a benchtop microcentrifuge. The microarray was warmed to room temperature and prehybridized with 200 µL of 1X hybridization buffer for 10–20 minutes at 45°C. The prehybridization solution was removed and 200 µL ofthe hybridization mix was added to the array. The array and probe fragments were incubated at 45°C overnight (16–20 hours) in a rotating oven (Affymetrix).
Sample_scan_protocol	According to the Affymetrix protocol: after hybridization, nonspecifically bound probe was removed by washing with the GeneChip Fluidics station 400 (Affymetrix). In total, 10 low-stringency washes (6x SSPE, 0.01% Tween-20, 0.005% Antifoam) and 4 high-stringency washes (100 mM MES, 0.1 M NaCl, 0.01% Tween-20, 50oC) were per- formed (all reagents from Sigma). Specifically bound probe was detected by incubating the arrays with SAPE (Molecular Probes) and scanning the chips with a Hewlett-Packard GeneArray scanner (Affymetrix).
Sample_data_processing	Robust multichip analysis method (RMA)
Sample_platform_id	GPL339
Sample_contact_name	Hana,C.,Friedman
Sample_contact_email	cheryl.friedman@mcgill.ca
Sample_contact_phone	514934193435162
Sample_contact_laboratory	Peterson Laboratory of Developmental Biology
Sample_contact_institute	McGill University
Sample_contact_address	687 Pine Ave. West
Sample_contact_city	Montreal
Sample_contact_zip/postal_code	H3A 1A1
Sample_contact_country	Canada
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM604nnn/GSM604482/suppl/GSM604482.CEL.gz
Sample_series_id	GSE24513
Sample_data_row_count	22690

GSM604483

GPL339

optic nerve_P4_rep2

optic nerves, 55 P4 mouse pups

strain: C57Bl/6J age: P4 tissue: optic nerve

The microarray experiments were performed at the McGill University and Génome Québec Innovation Centre, Montréal, Canada

Sample_geo_accession	GSM604483
Sample_status	Public on May 16 2011
Sample_submission_date	Oct 04 2010
Sample_last_update_date	May 16 2011
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Mus musculus
Sample_taxid_ch1	10090
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	Optic nerves were dissected into RNAlater (Ambion) and placed at 4∞C overnight before being stored at –80. Each pool of optic nerves was homogenized in Trizol (Life Technologies) using a glass/glass homogenizer. Following chloroform extraction, the lysate was purified using an RNAeasy column (Qiagen). RNA quality was assessed using an Agilent Bioanalyzer.
Sample_label_ch1	biotin
Sample_label_protocol_ch1	The Affymetrix One-cycle Target Labeling protocol was used. The RNA samples were first converted to double stranded cDNA. 10 micrograms of total RNA were mixed with 100 pM of T7-(T)24 primer (Genset, 5’ GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(dT)24-3’) in a 10 µl volume. The primer-RNA mixture was denatured for 10 minutes at 70°C and then chilled on ice. First-strand cDNA synthesis was performed using 2 µL Superscript II reverse transcriptase (Invitrogen Life Technologies) in a 20-µL reaction volume containing 10 µM dithiothreitol, 500 µM each dNTP, and 1X first-strand buffer(all from Invitrogen Life Technologies) for 60 minutes at 42°C. Second-strand synthesis was performed by adding to the first strand reaction mix: 40 units DNA polymerase I,(Invitrogen Life Technologies) 10 units Escherichia coli DNA ligase, (Invitrogen Life Technologies) and 2 units RNase H (MBI Fermentas) in a final reaction volume of 150 µL containing 1X second-strand buffer (Invitrogen Life Technologies). The reaction mixture was incubated at 16°C for 2 hours. Ten units of T4 DNA polymerase(MBI Fermentas)was added and incubated at 16°C for 5 minutes followed by the addition of 10 µL of 0.5 M EDTA (Sigma). After second-strand synthesis, the cDNA was purified by phenol chloroform extraction with Phase-Lock tubes (Eppendorf). The purified cDNA was used to generate the biotinylated cRNA probe with the Bioarray High Yield RNA transcript labeling kit (Enzo diagnostics)as indicated by the supplier. The labeled cRNA was then purified using the RNeasy total RNA clean up protocol(Qiagen).
Sample_hyb_protocol	According to the Affymetrix protocol: the hybridization mixture was prepared by mixing 15 µg of the biotinylated probe cRNA with control oligonucleotide B2 (final concentration 50 pM; Affymetrix), herring sperm DNA (final concentration 0.1 mg/ml; Research Genetics), acetylated bovine serum albumin (final concentration 0.5 mg/ml; Invitrogen Life Technologies) in a final volume of 300 µL of 1X MES hybridization buffer (100 mM MES, 1 M NaCl, 20 mM EDTA, 0.01% Tween-20; all reagents from Sigma). The hybridization mixture was denatured for 10 minutes at 99°C, incubated for 5 minutes at 45°C, and spun for 5 minutes in a benchtop microcentrifuge. The microarray was warmed to room temperature and prehybridized with 200 µL of 1X hybridization buffer for 10–20 minutes at 45°C. The prehybridization solution was removed and 200 µL ofthe hybridization mix was added to the array. The array and probe fragments were incubated at 45°C overnight (16–20 hours) in a rotating oven (Affymetrix).
Sample_scan_protocol	According to the Affymetrix protocol: after hybridization, nonspecifically bound probe was removed by washing with the GeneChip Fluidics station 400 (Affymetrix). In total, 10 low-stringency washes (6x SSPE, 0.01% Tween-20, 0.005% Antifoam) and 4 high-stringency washes (100 mM MES, 0.1 M NaCl, 0.01% Tween-20, 50oC) were per- formed (all reagents from Sigma). Specifically bound probe was detected by incubating the arrays with SAPE (Molecular Probes) and scanning the chips with a Hewlett-Packard GeneArray scanner (Affymetrix).
Sample_data_processing	Robust multichip analysis method (RMA)
Sample_platform_id	GPL339
Sample_contact_name	Hana,C.,Friedman
Sample_contact_email	cheryl.friedman@mcgill.ca
Sample_contact_phone	514934193435162
Sample_contact_laboratory	Peterson Laboratory of Developmental Biology
Sample_contact_institute	McGill University
Sample_contact_address	687 Pine Ave. West
Sample_contact_city	Montreal
Sample_contact_zip/postal_code	H3A 1A1
Sample_contact_country	Canada
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM604nnn/GSM604483/suppl/GSM604483.CEL.gz
Sample_series_id	GSE24513
Sample_data_row_count	22690

Make groups for comparisons

(2 groups will be compared at a time)

Select GSMs and click on "Add groups"

Enter the group name here:

Select expression type

Transcripts profile based on;

A. Differential status (Up/Down regulation)

B. Absolute calls (Transcribed/Not-detected)

Filter results by number of probes