Search results for the GEO ID: GSE27931  |
(Click on the check boxes provided under "Select for analysis", to initiate grouping) |
(Once the selection is made, click on "Add groups" in "Make groups for comparison", to make a group. Scroll down) |
|
GSM ID | GPL ID |
Select for analysis |
Title |
Source name |
Description |
Characteristics |
GSM690756 | GPL570 |
|
GBM_stem_A_control
|
GBM_stem_A_control
|
cell line: GBM-1
genotype/variation: control
|
GBM_stem_A_control
|
| Sample_geo_accession | GSM690756
| | Sample_status | Public on Mar 14 2011
| | Sample_submission_date | Mar 14 2011
| | Sample_last_update_date | Mar 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Microarray expression analysis of shTR1- and shTR2-expressing GBM-1 knockdown cells compared to non-targeting shRNA-expressing control cells TRRAP (shTR1, target sequence: CGTGTAAGAAAGGGAGAATAT; shTR2, target sequence: GCCCTGTTCTTTCGCTTTGTA). Total RNA for each sample was obtained after short term puromycin selection (5 ug/mL for 2 days followed by 1 ug/mL for 2 days) from two independent lentiviral infections and pooled prior to RNA preparation.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNeasy kits (Qiagen) were used to extract total RNA from brain tumor initiating cells. The integrity and concentration of RNA was determined via microfluidic analysis on an Experion instrument (BioRad).
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | GeneChip 3' IVT Express kits (Affymetrix) were used to amplify cRNA from 500 ng total RNA.
| | Sample_hyb_protocol | Standard Affymetrix protocols
| | Sample_scan_protocol | standard Affymetrix procedures
| | Sample_data_processing | MAS5
| | Sample_platform_id | GPL570
| | Sample_contact_name | John,R,Walker
| | Sample_contact_email | jwalker@gnf.org
| | Sample_contact_phone | 858-812-1636
| | Sample_contact_laboratory | Genetics Core
| | Sample_contact_department |
| | Sample_contact_institute | Genomics Institute of the Novartis Research Foundation
| | Sample_contact_address | 10675 John Jay Hopkins
| | Sample_contact_city | San Diego
| | Sample_contact_state | CA
| | Sample_contact_zip/postal_code | 92121
| | Sample_contact_country | USA
| | Sample_contact_web_link | http://biogps.gnf.org
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM690nnn/GSM690756/suppl/GSM690756.CEL.gz
| | Sample_series_id | GSE27931
| | Sample_data_row_count | 54675
| | |
|
GSM690757 | GPL570 |
|
GBM_stem_A_BMP_shRNA_B8
|
GBM_stem_A_BMP_shRNA_B8
|
cell line: GBM-1
genotype/variation: shTR1-mediated TRRAP knockdown
|
GBM_stem_A_BMP_shRNA_B8
|
| Sample_geo_accession | GSM690757
| | Sample_status | Public on Mar 14 2011
| | Sample_submission_date | Mar 14 2011
| | Sample_last_update_date | Mar 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Microarray expression analysis of shTR1- and shTR2-expressing GBM-1 knockdown cells compared to non-targeting shRNA-expressing control cells TRRAP (shTR1, target sequence: CGTGTAAGAAAGGGAGAATAT; shTR2, target sequence: GCCCTGTTCTTTCGCTTTGTA). Total RNA for each sample was obtained after short term puromycin selection (5 ug/mL for 2 days followed by 1 ug/mL for 2 days) from two independent lentiviral infections and pooled prior to RNA preparation.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNeasy kits (Qiagen) were used to extract total RNA from brain tumor initiating cells. The integrity and concentration of RNA was determined via microfluidic analysis on an Experion instrument (BioRad).
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | GeneChip 3' IVT Express kits (Affymetrix) were used to amplify cRNA from 500 ng total RNA.
| | Sample_hyb_protocol | Standard Affymetrix protocols
| | Sample_scan_protocol | standard Affymetrix procedures
| | Sample_data_processing | MAS5
| | Sample_platform_id | GPL570
| | Sample_contact_name | John,R,Walker
| | Sample_contact_email | jwalker@gnf.org
| | Sample_contact_phone | 858-812-1636
| | Sample_contact_laboratory | Genetics Core
| | Sample_contact_department |
| | Sample_contact_institute | Genomics Institute of the Novartis Research Foundation
| | Sample_contact_address | 10675 John Jay Hopkins
| | Sample_contact_city | San Diego
| | Sample_contact_state | CA
| | Sample_contact_zip/postal_code | 92121
| | Sample_contact_country | USA
| | Sample_contact_web_link | http://biogps.gnf.org
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM690nnn/GSM690757/suppl/GSM690757.CEL.gz
| | Sample_series_id | GSE27931
| | Sample_data_row_count | 54675
| | |
|
GSM690758 | GPL570 |
|
GBM_stem_F_shRNA_B9
|
GBM_stem_F_shRNA_B9
|
cell line: GBM-1
genotype/variation: shTR2-mediated TRRAP knockdown
|
GBM_stem_F_shRNA_B9
|
| Sample_geo_accession | GSM690758
| | Sample_status | Public on Mar 14 2011
| | Sample_submission_date | Mar 14 2011
| | Sample_last_update_date | Mar 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Homo sapiens
| | Sample_taxid_ch1 | 9606
| | Sample_treatment_protocol_ch1 | Microarray expression analysis of shTR1- and shTR2-expressing GBM-1 knockdown cells compared to non-targeting shRNA-expressing control cells TRRAP (shTR1, target sequence: CGTGTAAGAAAGGGAGAATAT; shTR2, target sequence: GCCCTGTTCTTTCGCTTTGTA). Total RNA for each sample was obtained after short term puromycin selection (5 ug/mL for 2 days followed by 1 ug/mL for 2 days) from two independent lentiviral infections and pooled prior to RNA preparation.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNeasy kits (Qiagen) were used to extract total RNA from brain tumor initiating cells. The integrity and concentration of RNA was determined via microfluidic analysis on an Experion instrument (BioRad).
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | GeneChip 3' IVT Express kits (Affymetrix) were used to amplify cRNA from 500 ng total RNA.
| | Sample_hyb_protocol | Standard Affymetrix protocols
| | Sample_scan_protocol | standard Affymetrix procedures
| | Sample_data_processing | MAS5
| | Sample_platform_id | GPL570
| | Sample_contact_name | John,R,Walker
| | Sample_contact_email | jwalker@gnf.org
| | Sample_contact_phone | 858-812-1636
| | Sample_contact_laboratory | Genetics Core
| | Sample_contact_department |
| | Sample_contact_institute | Genomics Institute of the Novartis Research Foundation
| | Sample_contact_address | 10675 John Jay Hopkins
| | Sample_contact_city | San Diego
| | Sample_contact_state | CA
| | Sample_contact_zip/postal_code | 92121
| | Sample_contact_country | USA
| | Sample_contact_web_link | http://biogps.gnf.org
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM690nnn/GSM690758/suppl/GSM690758.CEL.gz
| | Sample_series_id | GSE27931
| | Sample_data_row_count | 54675
| | |
|
| |
| |
Make groups for comparisons |
(2 groups will be compared at a time) |
|
| Select GSMs and click on "Add groups" |
Enter the group name here: |
|
|
|
Select expression type |
| Transcripts profile based on; |
A. Differential status (Up/Down regulation) |
|
|
Regulation type |
|
Fold change |
|
p-value |
|
|
|
B. Absolute calls (Transcribed/Not-detected) |
|
|
| Derive calls within/across groups |
Within groups |
|
|
Detection status |
|
Percentage detection |
|
|
Across groups |
|
|
Detection status |
First group: |
- |
Second group:
|
Percentage detection |
First group: |
- |
Second group:
|
|
|
| |
Filter results by number of probes |
|
|
