Result

Search results for the GEO ID: GSE30501

(Click on the check boxes provided under "Select for analysis", to initiate grouping)

(Once the selection is made, click on "Add groups" in "Make groups for comparison", to make a group. Scroll down)

GSM ID

GPL ID

Select for analysis

Title

Source name

Description

Characteristics

GSM756539

GPL570

parental TOV21G cell line

Parental cells

treatment: control cell line: TOV21G

Gene expression data from parental TOV21G cell line

Sample_geo_accession	GSM756539
Sample_status	Public on Dec 05 2011
Sample_submission_date	Jul 08 2011
Sample_last_update_date	Dec 05 2011
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	MISSION TRC shRNA Lentiviral Particles (Sigma-Aldrich, MO, USA) targeting various regions of PAX2 (shRNA 15839, CCGGCGTCTCTTCCATCAACAGAATCTCGAGATTCTGTTGATGGAAGAGACGTTTTT; shRNA 15840, CCGGCCCAAAGTGGTGGACAAGATTCTCGAGAATCTTGTCCACCACTTTGGGTTTTT; shRNA 15841, CCGGGATGAAGTCAAGTCGAGTCTACTCGAGTAGACTCGACTTGACTTCATCTTTTT) were used to transduce the parental ovarian cancer cell lines that expressed PAX2. The control lentivirus PLKO-puro (no insert sequence) (Sigma-Aldrich, MO, USA) and shRNA non-target control (insert sequence: CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT) (Sigma-Aldrich, MO, USA) were used as negative controls. Puromycin was used to select transfected cells. After stable knockdown, western blot and real-time reverse transcription polymerase chain reaction (RT-PCR) were used to confirm the efficacy of PAX2 knockdown.
Sample_growth_protocol_ch1	All cells were grown in Roswell Park Memorial Institute-1640 (RPMI-1640) with 10% fetal bovine serum and 1% penicillin/streptomycin in 5% CO2 at 37°C.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	Total RNA was extracted from cell culture using RNEasy Kit
Sample_label_ch1	biotin
Sample_label_protocol_ch1	The GeneChip® 3’ IVT Express Kit was used to synthesize first-strand cDNA from total RNA by revderse transcription. The cDNA was then converted into a double-stranded DNA template for transcription. Biotin-congugated nucleotide (cRNA) was then generated by In vitro transcription. synthesize first-strand cDNA. This cDNA is then converted into a double-stranded DNA template for transcription. In vitro transcription synthesizes aRNA and incorporates a biotin-congugated nucleotide (cRNA is also known as amplified RNA or aRNA). The aRNA is then purified to remove unincorporated NTPs, salts, enzymes, and inorganic phosphate. Fragmentation of the biotin-labeled aRNA prepares the sample for hybridization onto GeneChip 3’ expression arrays.
Sample_hyb_protocol	Biotin-labeled cDNA was hybridized to Affymetrix GeneChip U133A Plus 2.0 arrays according to manufacturer's instructions.
Sample_scan_protocol	Slides were scanned using the Affymetrix 7G scanner, and CEL files generated using Expression Console software
Sample_data_processing	All CEL files were imported into dChip2010, normalized with invariant set with TOV21G_PAX2_15841 as baseline, and expression values were obtained using Model-based expression with PM signal only
Sample_platform_id	GPL570
Sample_contact_name	Kwong-Kwok,,Wong
Sample_contact_email	kkwong@mdanderson.org
Sample_contact_phone	713-792-0229
Sample_contact_department	Gynecologic Oncology
Sample_contact_institute	UT M. D. Anderson Cancer Center
Sample_contact_address	T4-3900, 1515 Holcombe Boulevard
Sample_contact_city	Houston
Sample_contact_state	TX
Sample_contact_zip/postal_code	77030
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM756nnn/GSM756539/suppl/GSM756539_TOV21G_control.CEL.gz
Sample_series_id	GSE30501
Sample_data_row_count	54675

GSM756540

GPL570

non-target shRNA puromycin stable TOV21G cell line

vector control

treatment: vector control cell line: TOV21G

Gene expression data from non-target shRNA puromycin stable TOV21G cell line

Sample_geo_accession	GSM756540
Sample_status	Public on Dec 05 2011
Sample_submission_date	Jul 08 2011
Sample_last_update_date	Dec 05 2011
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	MISSION TRC shRNA Lentiviral Particles (Sigma-Aldrich, MO, USA) targeting various regions of PAX2 (shRNA 15839, CCGGCGTCTCTTCCATCAACAGAATCTCGAGATTCTGTTGATGGAAGAGACGTTTTT; shRNA 15840, CCGGCCCAAAGTGGTGGACAAGATTCTCGAGAATCTTGTCCACCACTTTGGGTTTTT; shRNA 15841, CCGGGATGAAGTCAAGTCGAGTCTACTCGAGTAGACTCGACTTGACTTCATCTTTTT) were used to transduce the parental ovarian cancer cell lines that expressed PAX2. The control lentivirus PLKO-puro (no insert sequence) (Sigma-Aldrich, MO, USA) and shRNA non-target control (insert sequence: CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT) (Sigma-Aldrich, MO, USA) were used as negative controls. Puromycin was used to select transfected cells. After stable knockdown, western blot and real-time reverse transcription polymerase chain reaction (RT-PCR) were used to confirm the efficacy of PAX2 knockdown.
Sample_growth_protocol_ch1	All cells were grown in Roswell Park Memorial Institute-1640 (RPMI-1640) with 10% fetal bovine serum and 1% penicillin/streptomycin in 5% CO2 at 37°C.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	Total RNA was extracted from cell culture using RNEasy Kit
Sample_label_ch1	biotin
Sample_label_protocol_ch1	The GeneChip® 3’ IVT Express Kit was used to synthesize first-strand cDNA from total RNA by revderse transcription. The cDNA was then converted into a double-stranded DNA template for transcription. Biotin-congugated nucleotide (cRNA) was then generated by In vitro transcription. synthesize first-strand cDNA. This cDNA is then converted into a double-stranded DNA template for transcription. In vitro transcription synthesizes aRNA and incorporates a biotin-congugated nucleotide (cRNA is also known as amplified RNA or aRNA). The aRNA is then purified to remove unincorporated NTPs, salts, enzymes, and inorganic phosphate. Fragmentation of the biotin-labeled aRNA prepares the sample for hybridization onto GeneChip 3’ expression arrays.
Sample_hyb_protocol	Biotin-labeled cDNA was hybridized to Affymetrix GeneChip U133A Plus 2.0 arrays according to manufacturer's instructions.
Sample_scan_protocol	Slides were scanned using the Affymetrix 7G scanner, and CEL files generated using Expression Console software
Sample_data_processing	All CEL files were imported into dChip2010, normalized with invariant set with TOV21G_PAX2_15841 as baseline, and expression values were obtained using Model-based expression with PM signal only
Sample_platform_id	GPL570
Sample_contact_name	Kwong-Kwok,,Wong
Sample_contact_email	kkwong@mdanderson.org
Sample_contact_phone	713-792-0229
Sample_contact_department	Gynecologic Oncology
Sample_contact_institute	UT M. D. Anderson Cancer Center
Sample_contact_address	T4-3900, 1515 Holcombe Boulevard
Sample_contact_city	Houston
Sample_contact_state	TX
Sample_contact_zip/postal_code	77030
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM756nnn/GSM756540/suppl/GSM756540_TOV21G_PLKO-1.CEL.gz
Sample_series_id	GSE30501
Sample_data_row_count	54675

GSM756541

GPL570

PLKO-1 vector control puromycin stable TOV21G cell line

non-target shRNA control

treatment: non-target control cell line: TOV21G

Gene expression data fromPLKO-1 vector control puromycin stable TOV21G cell line

Sample_geo_accession	GSM756541
Sample_status	Public on Dec 05 2011
Sample_submission_date	Jul 08 2011
Sample_last_update_date	Dec 05 2011
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	MISSION TRC shRNA Lentiviral Particles (Sigma-Aldrich, MO, USA) targeting various regions of PAX2 (shRNA 15839, CCGGCGTCTCTTCCATCAACAGAATCTCGAGATTCTGTTGATGGAAGAGACGTTTTT; shRNA 15840, CCGGCCCAAAGTGGTGGACAAGATTCTCGAGAATCTTGTCCACCACTTTGGGTTTTT; shRNA 15841, CCGGGATGAAGTCAAGTCGAGTCTACTCGAGTAGACTCGACTTGACTTCATCTTTTT) were used to transduce the parental ovarian cancer cell lines that expressed PAX2. The control lentivirus PLKO-puro (no insert sequence) (Sigma-Aldrich, MO, USA) and shRNA non-target control (insert sequence: CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT) (Sigma-Aldrich, MO, USA) were used as negative controls. Puromycin was used to select transfected cells. After stable knockdown, western blot and real-time reverse transcription polymerase chain reaction (RT-PCR) were used to confirm the efficacy of PAX2 knockdown.
Sample_growth_protocol_ch1	All cells were grown in Roswell Park Memorial Institute-1640 (RPMI-1640) with 10% fetal bovine serum and 1% penicillin/streptomycin in 5% CO2 at 37°C.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	Total RNA was extracted from cell culture using RNEasy Kit
Sample_label_ch1	biotin
Sample_label_protocol_ch1	The GeneChip® 3’ IVT Express Kit was used to synthesize first-strand cDNA from total RNA by revderse transcription. The cDNA was then converted into a double-stranded DNA template for transcription. Biotin-congugated nucleotide (cRNA) was then generated by In vitro transcription. synthesize first-strand cDNA. This cDNA is then converted into a double-stranded DNA template for transcription. In vitro transcription synthesizes aRNA and incorporates a biotin-congugated nucleotide (cRNA is also known as amplified RNA or aRNA). The aRNA is then purified to remove unincorporated NTPs, salts, enzymes, and inorganic phosphate. Fragmentation of the biotin-labeled aRNA prepares the sample for hybridization onto GeneChip 3’ expression arrays.
Sample_hyb_protocol	Biotin-labeled cDNA was hybridized to Affymetrix GeneChip U133A Plus 2.0 arrays according to manufacturer's instructions.
Sample_scan_protocol	Slides were scanned using the Affymetrix 7G scanner, and CEL files generated using Expression Console software
Sample_data_processing	All CEL files were imported into dChip2010, normalized with invariant set with TOV21G_PAX2_15841 as baseline, and expression values were obtained using Model-based expression with PM signal only
Sample_platform_id	GPL570
Sample_contact_name	Kwong-Kwok,,Wong
Sample_contact_email	kkwong@mdanderson.org
Sample_contact_phone	713-792-0229
Sample_contact_department	Gynecologic Oncology
Sample_contact_institute	UT M. D. Anderson Cancer Center
Sample_contact_address	T4-3900, 1515 Holcombe Boulevard
Sample_contact_city	Houston
Sample_contact_state	TX
Sample_contact_zip/postal_code	77030
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM756nnn/GSM756541/suppl/GSM756541_TOV21G_non-target.CEL.gz
Sample_series_id	GSE30501
Sample_data_row_count	54675

GSM756542

GPL570

PAX2 shRNA 15839 puromycin stable TOV21G cell line

PAX2 knockdown cell

treatment: PAX2 knockdown cell line: TOV21G

Gene expression data from PAX2 shRNA15839 puromycin stable TOV21G cell line

Sample_geo_accession	GSM756542
Sample_status	Public on Dec 05 2011
Sample_submission_date	Jul 08 2011
Sample_last_update_date	Dec 05 2011
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	MISSION TRC shRNA Lentiviral Particles (Sigma-Aldrich, MO, USA) targeting various regions of PAX2 (shRNA 15839, CCGGCGTCTCTTCCATCAACAGAATCTCGAGATTCTGTTGATGGAAGAGACGTTTTT; shRNA 15840, CCGGCCCAAAGTGGTGGACAAGATTCTCGAGAATCTTGTCCACCACTTTGGGTTTTT; shRNA 15841, CCGGGATGAAGTCAAGTCGAGTCTACTCGAGTAGACTCGACTTGACTTCATCTTTTT) were used to transduce the parental ovarian cancer cell lines that expressed PAX2. The control lentivirus PLKO-puro (no insert sequence) (Sigma-Aldrich, MO, USA) and shRNA non-target control (insert sequence: CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT) (Sigma-Aldrich, MO, USA) were used as negative controls. Puromycin was used to select transfected cells. After stable knockdown, western blot and real-time reverse transcription polymerase chain reaction (RT-PCR) were used to confirm the efficacy of PAX2 knockdown.
Sample_growth_protocol_ch1	All cells were grown in Roswell Park Memorial Institute-1640 (RPMI-1640) with 10% fetal bovine serum and 1% penicillin/streptomycin in 5% CO2 at 37°C.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	Total RNA was extracted from cell culture using RNEasy Kit
Sample_label_ch1	biotin
Sample_label_protocol_ch1	The GeneChip® 3’ IVT Express Kit was used to synthesize first-strand cDNA from total RNA by revderse transcription. The cDNA was then converted into a double-stranded DNA template for transcription. Biotin-congugated nucleotide (cRNA) was then generated by In vitro transcription. synthesize first-strand cDNA. This cDNA is then converted into a double-stranded DNA template for transcription. In vitro transcription synthesizes aRNA and incorporates a biotin-congugated nucleotide (cRNA is also known as amplified RNA or aRNA). The aRNA is then purified to remove unincorporated NTPs, salts, enzymes, and inorganic phosphate. Fragmentation of the biotin-labeled aRNA prepares the sample for hybridization onto GeneChip 3’ expression arrays.
Sample_hyb_protocol	Biotin-labeled cDNA was hybridized to Affymetrix GeneChip U133A Plus 2.0 arrays according to manufacturer's instructions.
Sample_scan_protocol	Slides were scanned using the Affymetrix 7G scanner, and CEL files generated using Expression Console software
Sample_data_processing	All CEL files were imported into dChip2010, normalized with invariant set with TOV21G_PAX2_15841 as baseline, and expression values were obtained using Model-based expression with PM signal only
Sample_platform_id	GPL570
Sample_contact_name	Kwong-Kwok,,Wong
Sample_contact_email	kkwong@mdanderson.org
Sample_contact_phone	713-792-0229
Sample_contact_department	Gynecologic Oncology
Sample_contact_institute	UT M. D. Anderson Cancer Center
Sample_contact_address	T4-3900, 1515 Holcombe Boulevard
Sample_contact_city	Houston
Sample_contact_state	TX
Sample_contact_zip/postal_code	77030
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM756nnn/GSM756542/suppl/GSM756542_TOV21G_PAX2_15839.CEL.gz
Sample_series_id	GSE30501
Sample_data_row_count	54675

GSM756543

GPL570

PAX2 shRNA 15840 puromycin stable TOV21G cell line

PAX2 knockdown cell

treatment: PAX2 knockdown cell line: TOV21G

Gene expression data from PAX2 shRNA15840 puromycin stable TOV21G cell line

Sample_geo_accession	GSM756543
Sample_status	Public on Dec 05 2011
Sample_submission_date	Jul 08 2011
Sample_last_update_date	Dec 05 2011
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	MISSION TRC shRNA Lentiviral Particles (Sigma-Aldrich, MO, USA) targeting various regions of PAX2 (shRNA 15839, CCGGCGTCTCTTCCATCAACAGAATCTCGAGATTCTGTTGATGGAAGAGACGTTTTT; shRNA 15840, CCGGCCCAAAGTGGTGGACAAGATTCTCGAGAATCTTGTCCACCACTTTGGGTTTTT; shRNA 15841, CCGGGATGAAGTCAAGTCGAGTCTACTCGAGTAGACTCGACTTGACTTCATCTTTTT) were used to transduce the parental ovarian cancer cell lines that expressed PAX2. The control lentivirus PLKO-puro (no insert sequence) (Sigma-Aldrich, MO, USA) and shRNA non-target control (insert sequence: CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT) (Sigma-Aldrich, MO, USA) were used as negative controls. Puromycin was used to select transfected cells. After stable knockdown, western blot and real-time reverse transcription polymerase chain reaction (RT-PCR) were used to confirm the efficacy of PAX2 knockdown.
Sample_growth_protocol_ch1	All cells were grown in Roswell Park Memorial Institute-1640 (RPMI-1640) with 10% fetal bovine serum and 1% penicillin/streptomycin in 5% CO2 at 37°C.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	Total RNA was extracted from cell culture using RNEasy Kit
Sample_label_ch1	biotin
Sample_label_protocol_ch1	The GeneChip® 3’ IVT Express Kit was used to synthesize first-strand cDNA from total RNA by revderse transcription. The cDNA was then converted into a double-stranded DNA template for transcription. Biotin-congugated nucleotide (cRNA) was then generated by In vitro transcription. synthesize first-strand cDNA. This cDNA is then converted into a double-stranded DNA template for transcription. In vitro transcription synthesizes aRNA and incorporates a biotin-congugated nucleotide (cRNA is also known as amplified RNA or aRNA). The aRNA is then purified to remove unincorporated NTPs, salts, enzymes, and inorganic phosphate. Fragmentation of the biotin-labeled aRNA prepares the sample for hybridization onto GeneChip 3’ expression arrays.
Sample_hyb_protocol	Biotin-labeled cDNA was hybridized to Affymetrix GeneChip U133A Plus 2.0 arrays according to manufacturer's instructions.
Sample_scan_protocol	Slides were scanned using the Affymetrix 7G scanner, and CEL files generated using Expression Console software
Sample_data_processing	All CEL files were imported into dChip2010, normalized with invariant set with TOV21G_PAX2_15841 as baseline, and expression values were obtained using Model-based expression with PM signal only
Sample_platform_id	GPL570
Sample_contact_name	Kwong-Kwok,,Wong
Sample_contact_email	kkwong@mdanderson.org
Sample_contact_phone	713-792-0229
Sample_contact_department	Gynecologic Oncology
Sample_contact_institute	UT M. D. Anderson Cancer Center
Sample_contact_address	T4-3900, 1515 Holcombe Boulevard
Sample_contact_city	Houston
Sample_contact_state	TX
Sample_contact_zip/postal_code	77030
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM756nnn/GSM756543/suppl/GSM756543_TOV21G_PAX2_15840.CEL.gz
Sample_series_id	GSE30501
Sample_data_row_count	54675

GSM756544

GPL570

PAX2 shRNA 15841 puromycin stable TOV21G cell line

PAX2 knockdown cell

treatment: PAX2 knockdown cell line: TOV21G

Gene expression data from PAX2 shRNA15841 puromycin stable TOV21G cell line

Sample_geo_accession	GSM756544
Sample_status	Public on Dec 05 2011
Sample_submission_date	Jul 08 2011
Sample_last_update_date	Dec 05 2011
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	MISSION TRC shRNA Lentiviral Particles (Sigma-Aldrich, MO, USA) targeting various regions of PAX2 (shRNA 15839, CCGGCGTCTCTTCCATCAACAGAATCTCGAGATTCTGTTGATGGAAGAGACGTTTTT; shRNA 15840, CCGGCCCAAAGTGGTGGACAAGATTCTCGAGAATCTTGTCCACCACTTTGGGTTTTT; shRNA 15841, CCGGGATGAAGTCAAGTCGAGTCTACTCGAGTAGACTCGACTTGACTTCATCTTTTT) were used to transduce the parental ovarian cancer cell lines that expressed PAX2. The control lentivirus PLKO-puro (no insert sequence) (Sigma-Aldrich, MO, USA) and shRNA non-target control (insert sequence: CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT) (Sigma-Aldrich, MO, USA) were used as negative controls. Puromycin was used to select transfected cells. After stable knockdown, western blot and real-time reverse transcription polymerase chain reaction (RT-PCR) were used to confirm the efficacy of PAX2 knockdown.
Sample_growth_protocol_ch1	All cells were grown in Roswell Park Memorial Institute-1640 (RPMI-1640) with 10% fetal bovine serum and 1% penicillin/streptomycin in 5% CO2 at 37°C.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	Total RNA was extracted from cell culture using RNEasy Kit
Sample_label_ch1	biotin
Sample_label_protocol_ch1	The GeneChip® 3’ IVT Express Kit was used to synthesize first-strand cDNA from total RNA by revderse transcription. The cDNA was then converted into a double-stranded DNA template for transcription. Biotin-congugated nucleotide (cRNA) was then generated by In vitro transcription. synthesize first-strand cDNA. This cDNA is then converted into a double-stranded DNA template for transcription. In vitro transcription synthesizes aRNA and incorporates a biotin-congugated nucleotide (cRNA is also known as amplified RNA or aRNA). The aRNA is then purified to remove unincorporated NTPs, salts, enzymes, and inorganic phosphate. Fragmentation of the biotin-labeled aRNA prepares the sample for hybridization onto GeneChip 3’ expression arrays.
Sample_hyb_protocol	Biotin-labeled cDNA was hybridized to Affymetrix GeneChip U133A Plus 2.0 arrays according to manufacturer's instructions.
Sample_scan_protocol	Slides were scanned using the Affymetrix 7G scanner, and CEL files generated using Expression Console software
Sample_data_processing	All CEL files were imported into dChip2010, normalized with invariant set with TOV21G_PAX2_15841 as baseline, and expression values were obtained using Model-based expression with PM signal only
Sample_platform_id	GPL570
Sample_contact_name	Kwong-Kwok,,Wong
Sample_contact_email	kkwong@mdanderson.org
Sample_contact_phone	713-792-0229
Sample_contact_department	Gynecologic Oncology
Sample_contact_institute	UT M. D. Anderson Cancer Center
Sample_contact_address	T4-3900, 1515 Holcombe Boulevard
Sample_contact_city	Houston
Sample_contact_state	TX
Sample_contact_zip/postal_code	77030
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM756nnn/GSM756544/suppl/GSM756544_TOV21G_PAX2_15841.CEL.gz
Sample_series_id	GSE30501
Sample_data_row_count	54675

Make groups for comparisons

(2 groups will be compared at a time)

Select GSMs and click on "Add groups"

Enter the group name here:

Select expression type

Transcripts profile based on;

A. Differential status (Up/Down regulation)

B. Absolute calls (Transcribed/Not-detected)

Filter results by number of probes