Result

Search results for the GEO ID: GSE41239

(Click on the check boxes provided under "Select for analysis", to initiate grouping)

(Once the selection is made, click on "Add groups" in "Make groups for comparison", to make a group. Scroll down)

GSM ID

GPL ID

Select for analysis

Title

Source name

Description

Characteristics

GSM1012074

GPL570

KARPAS-422 shNTC (10days), biological rep 1

KARPAS-422 shNTC

cell line: KARPAS-422 tissue type: DLBCL (diffuse large B-cell lymphoma) treatment: Non targetting Control (10days)

Gene expression data from Karpas-422 cell line treated with non targeting shRNA for 10 days - replicate1

Sample_geo_accession	GSM1012074
Sample_status	Public on Oct 12 2012
Sample_submission_date	Oct 01 2012
Sample_last_update_date	Oct 12 2012
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	Pfeiffer and KARPAS-422 cells plated in RPMI-1640 supplemented with 10% fetal bovine serum and 8 µg/ml polybrene were infected with lentiviral transduction particles (Sigma) containing shRNA specific for a non-mammalian control sequence or human EZH2. Sequences for the shRNA were as follows: shControl – CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT and shEZH2 – CCGGTATGATGGTTAACGGTGATCACTCGAGTGATCACCGTTAACCATCATATTTTTG. Two days after the addition of virus, cells were transferred to RPMI-1640 media supplemented with 10% fetal bovine serum and 1 µg/ml puromycin to select for infected cells. After 2 days of puromycin selection, cells were plated into 96 well plates.
Sample_growth_protocol_ch1	Cells were grown as recommended by ATCC or DSMZ.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	RNA extracted with Trizol reagent and purified per Trizol protocol; RNA further purified using RNeasy kit columns
Sample_label_ch1	biotin
Sample_label_protocol_ch1	According to manufacturer's instructions
Sample_hyb_protocol	According to manufacturer's instructions
Sample_scan_protocol	According to manufacturer's instructions
Sample_data_processing	Data was analyzed using MAS (Microarray Suite) v. 5.0 algorithm using default settings and global scaling as the normalization method. The trimmed mean target intensity of each array was set to 500
Sample_platform_id	GPL570
Sample_contact_name	Gopinath,,Ganji
Sample_contact_email	gopi@gsk.com
Sample_contact_institute	GSK
Sample_contact_address	1250 South Collegeville Road
Sample_contact_city	Collegeville
Sample_contact_state	PA
Sample_contact_zip/postal_code	19426
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM1012nnn/GSM1012074/suppl/GSM1012074_EA10008_235837_HG-U133_PLUS_2_R9-5.CEL.gz
Sample_series_id	GSE40972
Sample_series_id	GSE41239
Sample_data_row_count	54675

GSM1012075

GPL570

KARPAS-422 shEZH2 (10days), biological rep 1

KARPAS-422 shEZH2

cell line: KARPAS-422 tissue type: DLBCL (diffuse large B-cell lymphoma) treatment: shEZH2 (10days)

Gene expression data from Karpas-422 cell line treated with shRNA against EZH2 for 10 days-replicate1

Sample_geo_accession	GSM1012075
Sample_status	Public on Oct 12 2012
Sample_submission_date	Oct 01 2012
Sample_last_update_date	Oct 12 2012
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	Pfeiffer and KARPAS-422 cells plated in RPMI-1640 supplemented with 10% fetal bovine serum and 8 µg/ml polybrene were infected with lentiviral transduction particles (Sigma) containing shRNA specific for a non-mammalian control sequence or human EZH2. Sequences for the shRNA were as follows: shControl – CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT and shEZH2 – CCGGTATGATGGTTAACGGTGATCACTCGAGTGATCACCGTTAACCATCATATTTTTG. Two days after the addition of virus, cells were transferred to RPMI-1640 media supplemented with 10% fetal bovine serum and 1 µg/ml puromycin to select for infected cells. After 2 days of puromycin selection, cells were plated into 96 well plates.
Sample_growth_protocol_ch1	Cells were grown as recommended by ATCC or DSMZ.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	RNA extracted with Trizol reagent and purified per Trizol protocol; RNA further purified using RNeasy kit columns
Sample_label_ch1	biotin
Sample_label_protocol_ch1	According to manufacturer's instructions
Sample_hyb_protocol	According to manufacturer's instructions
Sample_scan_protocol	According to manufacturer's instructions
Sample_data_processing	Data was analyzed using MAS (Microarray Suite) v. 5.0 algorithm using default settings and global scaling as the normalization method. The trimmed mean target intensity of each array was set to 500
Sample_platform_id	GPL570
Sample_contact_name	Gopinath,,Ganji
Sample_contact_email	gopi@gsk.com
Sample_contact_institute	GSK
Sample_contact_address	1250 South Collegeville Road
Sample_contact_city	Collegeville
Sample_contact_state	PA
Sample_contact_zip/postal_code	19426
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM1012nnn/GSM1012075/suppl/GSM1012075_EA10008_235838_HG-U133_PLUS_2_R9-6.CEL.gz
Sample_series_id	GSE40972
Sample_series_id	GSE41239
Sample_data_row_count	54675

GSM1012076

GPL570

KARPAS-422 shNTC (10days), biological rep2

KARPAS-422 shNTC

cell line: KARPAS-422 tissue type: DLBCL (diffuse large B-cell lymphoma) treatment: Non targetting Control (10days)

Gene expression data from Karpas-422 cell line treated with non targeting shRNA for 10 days-replicate2

Sample_geo_accession	GSM1012076
Sample_status	Public on Oct 12 2012
Sample_submission_date	Oct 01 2012
Sample_last_update_date	Oct 12 2012
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	Pfeiffer and KARPAS-422 cells plated in RPMI-1640 supplemented with 10% fetal bovine serum and 8 µg/ml polybrene were infected with lentiviral transduction particles (Sigma) containing shRNA specific for a non-mammalian control sequence or human EZH2. Sequences for the shRNA were as follows: shControl – CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT and shEZH2 – CCGGTATGATGGTTAACGGTGATCACTCGAGTGATCACCGTTAACCATCATATTTTTG. Two days after the addition of virus, cells were transferred to RPMI-1640 media supplemented with 10% fetal bovine serum and 1 µg/ml puromycin to select for infected cells. After 2 days of puromycin selection, cells were plated into 96 well plates.
Sample_growth_protocol_ch1	Cells were grown as recommended by ATCC or DSMZ.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	RNA extracted with Trizol reagent and purified per Trizol protocol; RNA further purified using RNeasy kit columns
Sample_label_ch1	biotin
Sample_label_protocol_ch1	According to manufacturer's instructions
Sample_hyb_protocol	According to manufacturer's instructions
Sample_scan_protocol	According to manufacturer's instructions
Sample_data_processing	Data was analyzed using MAS (Microarray Suite) v. 5.0 algorithm using default settings and global scaling as the normalization method. The trimmed mean target intensity of each array was set to 500
Sample_platform_id	GPL570
Sample_contact_name	Gopinath,,Ganji
Sample_contact_email	gopi@gsk.com
Sample_contact_institute	GSK
Sample_contact_address	1250 South Collegeville Road
Sample_contact_city	Collegeville
Sample_contact_state	PA
Sample_contact_zip/postal_code	19426
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM1012nnn/GSM1012076/suppl/GSM1012076_EA10008_235840_HG-U133_PLUS_2_R10-2.CEL.gz
Sample_series_id	GSE40972
Sample_series_id	GSE41239
Sample_data_row_count	54675

GSM1012077

GPL570

KARPAS-422 shEZH2 (10days), biological rep 2

KARPAS-422 shEZH2

cell line: KARPAS-422 tissue type: DLBCL (diffuse large B-cell lymphoma) treatment: shEZH2 (10days)

Gene expression data from Karpas-422 cell line treated with shRNA against EZH2 for 10 days-replicate2

Sample_geo_accession	GSM1012077
Sample_status	Public on Oct 12 2012
Sample_submission_date	Oct 01 2012
Sample_last_update_date	Oct 12 2012
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	Pfeiffer and KARPAS-422 cells plated in RPMI-1640 supplemented with 10% fetal bovine serum and 8 µg/ml polybrene were infected with lentiviral transduction particles (Sigma) containing shRNA specific for a non-mammalian control sequence or human EZH2. Sequences for the shRNA were as follows: shControl – CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT and shEZH2 – CCGGTATGATGGTTAACGGTGATCACTCGAGTGATCACCGTTAACCATCATATTTTTG. Two days after the addition of virus, cells were transferred to RPMI-1640 media supplemented with 10% fetal bovine serum and 1 µg/ml puromycin to select for infected cells. After 2 days of puromycin selection, cells were plated into 96 well plates.
Sample_growth_protocol_ch1	Cells were grown as recommended by ATCC or DSMZ.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	RNA extracted with Trizol reagent and purified per Trizol protocol; RNA further purified using RNeasy kit columns
Sample_label_ch1	biotin
Sample_label_protocol_ch1	According to manufacturer's instructions
Sample_hyb_protocol	According to manufacturer's instructions
Sample_scan_protocol	According to manufacturer's instructions
Sample_data_processing	Data was analyzed using MAS (Microarray Suite) v. 5.0 algorithm using default settings and global scaling as the normalization method. The trimmed mean target intensity of each array was set to 500
Sample_platform_id	GPL570
Sample_contact_name	Gopinath,,Ganji
Sample_contact_email	gopi@gsk.com
Sample_contact_institute	GSK
Sample_contact_address	1250 South Collegeville Road
Sample_contact_city	Collegeville
Sample_contact_state	PA
Sample_contact_zip/postal_code	19426
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM1012nnn/GSM1012077/suppl/GSM1012077_EA10008_235841_HG-U133_PLUS_2_R10-3.CEL.gz
Sample_series_id	GSE40972
Sample_series_id	GSE41239
Sample_data_row_count	54675

GSM1012078

GPL570

Pfeiffer shNTC (10days)

Pfeiffer shNTC

cell line: Pfeiffer tissue type: DLBCL (diffuse large B-cell lymphoma) treatment: Non targetting Control (10days)

Gene expression data from Pfeiffer cell line treated with non targeting shRNA for 10 days

Sample_geo_accession	GSM1012078
Sample_status	Public on Oct 12 2012
Sample_submission_date	Oct 01 2012
Sample_last_update_date	Oct 12 2012
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	Pfeiffer and KARPAS-422 cells plated in RPMI-1640 supplemented with 10% fetal bovine serum and 8 µg/ml polybrene were infected with lentiviral transduction particles (Sigma) containing shRNA specific for a non-mammalian control sequence or human EZH2. Sequences for the shRNA were as follows: shControl – CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT and shEZH2 – CCGGTATGATGGTTAACGGTGATCACTCGAGTGATCACCGTTAACCATCATATTTTTG. Two days after the addition of virus, cells were transferred to RPMI-1640 media supplemented with 10% fetal bovine serum and 1 µg/ml puromycin to select for infected cells. After 2 days of puromycin selection, cells were plated into 96 well plates.
Sample_growth_protocol_ch1	Cells were grown as recommended by ATCC or DSMZ.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	RNA extracted with Trizol reagent and purified per Trizol protocol; RNA further purified using RNeasy kit columns
Sample_label_ch1	biotin
Sample_label_protocol_ch1	According to manufacturer's instructions
Sample_hyb_protocol	According to manufacturer's instructions
Sample_scan_protocol	According to manufacturer's instructions
Sample_data_processing	Data was analyzed using MAS (Microarray Suite) v. 5.0 algorithm using default settings and global scaling as the normalization method. The trimmed mean target intensity of each array was set to 500
Sample_platform_id	GPL570
Sample_contact_name	Gopinath,,Ganji
Sample_contact_email	gopi@gsk.com
Sample_contact_institute	GSK
Sample_contact_address	1250 South Collegeville Road
Sample_contact_city	Collegeville
Sample_contact_state	PA
Sample_contact_zip/postal_code	19426
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM1012nnn/GSM1012078/suppl/GSM1012078_EA10008_235843_HG-U133_PLUS_2_R10-5.CEL.gz
Sample_series_id	GSE40972
Sample_series_id	GSE41239
Sample_data_row_count	54675

GSM1012079

GPL570

Pfeiffer shEZH2 (10days)

Pfeiffer shEZH2

cell line: Pfeiffer tissue type: DLBCL (diffuse large B-cell lymphoma) treatment: shEZH2 (10days)

Gene expression data from Pfeiffer cell line treated with shRNA against EZH2 for 10 days

Sample_geo_accession	GSM1012079
Sample_status	Public on Oct 12 2012
Sample_submission_date	Oct 01 2012
Sample_last_update_date	Oct 12 2012
Sample_type	RNA
Sample_channel_count	1
Sample_organism_ch1	Homo sapiens
Sample_taxid_ch1	9606
Sample_treatment_protocol_ch1	Pfeiffer and KARPAS-422 cells plated in RPMI-1640 supplemented with 10% fetal bovine serum and 8 µg/ml polybrene were infected with lentiviral transduction particles (Sigma) containing shRNA specific for a non-mammalian control sequence or human EZH2. Sequences for the shRNA were as follows: shControl – CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT and shEZH2 – CCGGTATGATGGTTAACGGTGATCACTCGAGTGATCACCGTTAACCATCATATTTTTG. Two days after the addition of virus, cells were transferred to RPMI-1640 media supplemented with 10% fetal bovine serum and 1 µg/ml puromycin to select for infected cells. After 2 days of puromycin selection, cells were plated into 96 well plates.
Sample_growth_protocol_ch1	Cells were grown as recommended by ATCC or DSMZ.
Sample_molecule_ch1	total RNA
Sample_extract_protocol_ch1	RNA extracted with Trizol reagent and purified per Trizol protocol; RNA further purified using RNeasy kit columns
Sample_label_ch1	biotin
Sample_label_protocol_ch1	According to manufacturer's instructions
Sample_hyb_protocol	According to manufacturer's instructions
Sample_scan_protocol	According to manufacturer's instructions
Sample_data_processing	Data was analyzed using MAS (Microarray Suite) v. 5.0 algorithm using default settings and global scaling as the normalization method. The trimmed mean target intensity of each array was set to 500
Sample_platform_id	GPL570
Sample_contact_name	Gopinath,,Ganji
Sample_contact_email	gopi@gsk.com
Sample_contact_institute	GSK
Sample_contact_address	1250 South Collegeville Road
Sample_contact_city	Collegeville
Sample_contact_state	PA
Sample_contact_zip/postal_code	19426
Sample_contact_country	USA
Sample_supplementary_file	ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM1012nnn/GSM1012079/suppl/GSM1012079_EA10008_235844_HG-U133_PLUS_2_R10-6.CEL.gz
Sample_series_id	GSE40972
Sample_series_id	GSE41239
Sample_data_row_count	54675

Make groups for comparisons

(2 groups will be compared at a time)

Select GSMs and click on "Add groups"

Enter the group name here:

Select expression type

Transcripts profile based on;

A. Differential status (Up/Down regulation)

B. Absolute calls (Transcribed/Not-detected)

Filter results by number of probes