Search results for the GEO ID: GSE9738  |
(Click on the check boxes provided under "Select for analysis", to initiate grouping) |
(Once the selection is made, click on "Add groups" in "Make groups for comparison", to make a group. Scroll down) |
|
GSM ID | GPL ID |
Select for analysis |
Title |
Source name |
Description |
Characteristics |
GSM245998 | GPL339 |
|
DRG_control_2h_rep1
|
DRG explant cultured for 2 hours in vitro
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: control (cos cells mock-transfected)
|
none
|
| Sample_geo_accession | GSM245998
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM245nnn/GSM245998/suppl/GSM245998.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM245999 | GPL339 |
|
DRG_control_5h_rep1
|
DRG explant cultured for 5 hours in vitro
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: control (cos cells mock-transfected)
|
none
|
| Sample_geo_accession | GSM245999
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM245nnn/GSM245999/suppl/GSM245999.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246000 | GPL339 |
|
DRG_control_12h_rep1
|
DRG explant cultured for 12 hours in vitro
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: control (cos cells mock-transfected)
|
none
|
| Sample_geo_accession | GSM246000
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246000/suppl/GSM246000.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246001 | GPL339 |
|
DRG_control_24h_rep1
|
DRG explant cultured for 24 hours in vitro
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: control (cos cells mock-transfected)
|
none
|
| Sample_geo_accession | GSM246001
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246001/suppl/GSM246001.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246002 | GPL339 |
|
DRG_control_40h_rep1
|
DRG explant cultured for 48 hours in vitro
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: control (cos cells mock-transfected)
|
none
|
| Sample_geo_accession | GSM246002
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246002/suppl/GSM246002.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246003 | GPL339 |
|
DRG_sema3A_2h_rep1
|
DRG explant cultured for 2 hours in vitro, in the presence of Sema3A
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: exposed to Sema3A (cos cells Sema3A-transfected)
|
none
|
| Sample_geo_accession | GSM246003
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246003/suppl/GSM246003.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246004 | GPL339 |
|
DRG_sema3A_5h_rep1
|
DRG explant cultured for 5 hours in vitro, in the presence of Sema3A
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: exposed to Sema3A (cos cells Sema3A-transfected)
|
none
|
| Sample_geo_accession | GSM246004
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246004/suppl/GSM246004.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246005 | GPL339 |
|
DRG_sema3A_12h_rep1
|
DRG explant cultured for 12 hours in vitro, in the presence of Sema3A
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: exposed to Sema3A (cos cells Sema3A-transfected)
|
none
|
| Sample_geo_accession | GSM246005
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246005/suppl/GSM246005.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246006 | GPL339 |
|
DRG_sema3A_24h_rep1
|
DRG explant cultured for 24 hours in vitro, in the presence of Sema3A
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: exposed to Sema3A (cos cells Sema3A-transfected)
|
none
|
| Sample_geo_accession | GSM246006
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246006/suppl/GSM246006.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246007 | GPL339 |
|
DRG_sema3A_40h_rep1
|
DRG explant cultured for 48 hours in vitro, in the presence of Sema3A
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: exposed to Sema3A (cos cells Sema3A-transfected)
|
none
|
| Sample_geo_accession | GSM246007
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246007/suppl/GSM246007.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246008 | GPL339 |
|
DRG_control_2h_rep2
|
DRG explant cultured for 2 hours in vitro
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: control (cos cells mock-transfected)
|
none
|
| Sample_geo_accession | GSM246008
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246008/suppl/GSM246008.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246009 | GPL339 |
|
DRG_control_5h_rep2
|
DRG explant cultured for 5 hours in vitro
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: control (cos cells mock-transfected)
|
none
|
| Sample_geo_accession | GSM246009
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246009/suppl/GSM246009.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246010 | GPL339 |
|
DRG_control_12h_rep2
|
DRG explant cultured for 12 hours in vitro
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: control (cos cells mock-transfected)
|
none
|
| Sample_geo_accession | GSM246010
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246010/suppl/GSM246010.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246011 | GPL339 |
|
DRG_control_24h_rep2
|
DRG explant cultured for 24 hours in vitro
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: control (cos cells mock-transfected)
|
none
|
| Sample_geo_accession | GSM246011
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246011/suppl/GSM246011.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246012 | GPL339 |
|
DRG_control_40h_rep2
|
DRG explant cultured for 48 hours in vitro
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: control (cos cells mock-transfected)
|
none
|
| Sample_geo_accession | GSM246012
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246012/suppl/GSM246012.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246013 | GPL339 |
|
DRG_sema3A_2h_rep2
|
DRG explant cultured for 2 hours in vitro, in the presence of Sema3A
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: exposed to Sema3A (cos cells Sema3A-transfected)
|
none
|
| Sample_geo_accession | GSM246013
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246013/suppl/GSM246013.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246014 | GPL339 |
|
DRG_sema3A_5h_rep2
|
DRG explant cultured for 5 hours in vitro, in the presence of Sema3A
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: exposed to Sema3A (cos cells Sema3A-transfected)
|
none
|
| Sample_geo_accession | GSM246014
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246014/suppl/GSM246014.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246015 | GPL339 |
|
DRG_sema3A_12h_rep2
|
DRG explant cultured for 12 hours in vitro, in the presence of Sema3A
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: exposed to Sema3A (cos cells Sema3A-transfected)
|
none
|
| Sample_geo_accession | GSM246015
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246015/suppl/GSM246015.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246016 | GPL339 |
|
DRG_sema3A_24h_rep2
|
DRG explant cultured for 24 hours in vitro, in the presence of Sema3A
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: exposed to Sema3A (cos cells Sema3A-transfected)
|
none
|
| Sample_geo_accession | GSM246016
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246016/suppl/GSM246016.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246017 | GPL339 |
|
DRG_sema3A_40h_rep2
|
DRG explant cultured for 48 hours in vitro, in the presence of Sema3A
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: exposed to Sema3A (cos cells Sema3A-transfected)
|
none
|
| Sample_geo_accession | GSM246017
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246017/suppl/GSM246017.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246018 | GPL339 |
|
DRG_reference_pool
|
DRG acutely dissected from embryos
|
strain: CD1
age: embryonic day 12
tissue: dorsal root ganglia (DRG)
treatment: none (acutely dissected)
|
none
|
| Sample_geo_accession | GSM246018
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246018/suppl/GSM246018.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
GSM246019 | GPL339 |
|
SCG_reference_pool
|
SCG acutely dissected from embryos
|
strain: CD1
age: embryonic day 13
tissue: superior cervical ganglia (SCG)
treatment: none (acutely dissected)
|
none
|
| Sample_geo_accession | GSM246019
| | Sample_status | Public on Dec 04 2007
| | Sample_submission_date | Nov 30 2007
| | Sample_last_update_date | Aug 14 2011
| | Sample_type | RNA
| | Sample_channel_count | 1
| | Sample_organism_ch1 | Mus musculus
| | Sample_taxid_ch1 | 10090
| | Sample_treatment_protocol_ch1 | After dissection, two to four explants were embedded in a collagen sandwich with an aggregate of Cos7 cells. The Cos7 cells were either mock-transfected or transiently transfected with 5µg Sema3A plasmid, using Lipofectamine 2000 (Invitrogen) as per manufacturer’s instructions. Cultured DRG or SCG were harvested into Trizol at 2, 5, 12, 24, 40, and 65 hours (final time point for SCG only). A reference pool for microarray comparisons was created by dissecting explants as above, and transferring tissues to Trizol RNA isolation reagent (Invitrogen) without culturing.
| | Sample_growth_protocol_ch1 | For each culture, embryonic explants were dissected from two litters of outbred CD1 mice of either embryonic day 13 (E13) for SCG or E12 for DRG. Culture medium for SCG consisted of D-MEM/F-12 medium with 100 U/ml penicillin/streptomycin (P/S), 2 mM L-Glutamine (all Invitrogen, Carlsbad, CA), 1 mg/ml bovine albumin, and 25 ng/ml of NGF-7S (both Sigma, St. Louis, MO). Culture medium for DRG consisted of 1:1 F-12 and Opti-MEM I, 0.5% heat-inactivated horse serum, 2 mM GlutaMAX, 100 U/ml P/S, 40 mM glucose, and 25 ng/ml NGF.
| | Sample_molecule_ch1 | total RNA
| | Sample_extract_protocol_ch1 | RNA was isolated as per Invitrogen protocol, treated with RNase-free DNase (Promega, Madison, WI), cleaned via Zymo-RNA column (ZYMO Research, Orange, CA), and quantitated by Ribogreen assay (Molecular Probes/Invitrogen). For DRG samples, all five time points of each replicate were collected consecutively from one culture setup, making them continuous replicates. SCG sample tissue was more limited, and therefore the microarray replicates are discontinuous, composed of intermingled time points from multiple culture setups. Two biological replicates for each tissue type were collected for hybridization to Affymetrix arrays.
| | Sample_label_ch1 | biotin
| | Sample_label_protocol_ch1 | For each microarray sample, 50-500 ng of total RNA was amplified using a modified Eberwine procedure. 200 ng of T7-oligo dT primer was added to each (AAATTAATACGACTCACTATAGGGAGACCACA(T)21)). A 20 µl reverse transcription reaction was carried out for each sample using Superscript III (SSIII; Invitrogen) as per manufacturer’s protocol, with reaction time extended to 16 hours. Second strand cDNA synthesis utilized DNA ligase, DNA polymerase I holoenzyme (both New England Biolabs, Ipswich, MA), dNTPs, and second strand buffer (Invitrogen) for 2-6 hours at 16 degrees C. cDNA was isolated by phenol chloroform extraction and precipitated. cRNA was produced from cDNA with an Ambion T7 Megascript kit, and collected via Qiagen RNeasy column. RNA was quantitated by spectrophotometer and gel electrophoresis. Second round amplification followed the Affymetrix Small-Sample Target Labeling Assay Version II from step 6 onward. Biotin-labeled cRNA was made using the BioArray High Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY) and eluted by RNeasy column. cRNA was fragmented according to Affymetrix protocol.
| | Sample_hyb_protocol | All SCG samples were hybridized to Affymetrix MG-U74v2 A and B arrays, and DRG samples were hybridized to MOE430A arrays. All hybridizations were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_scan_protocol | All scans were performed via Affymetrix protocols at the Stanford Protein and Nucleic Acid Biotechnology Facility.
| | Sample_data_processing | Since SCG and DRG samples used two different series of Affymetrix arrays, the data for each was extracted separately. gcrma (version 1.1) was used to extract data. To balance the median array intensity between array platforms, a constant value of 1.83 was added to the logged intensity values for the SCG (MG-U74v2) arrays. Based on Affymetrix probeset descriptions and the disproportionate number of low-intensity probesets in these categories, probesets annotated as incomplete (i), rules dropped (r), or cross-hybridizing (x) were excluded. Data for each group of arrays was baselined to the appropriate (SCG or DRG) acutely-dissected reference pool. This facilitated comparison between Affymetrix platforms as well as to spotted microarray data. The Affymetrix same-species best-match comparison spreadsheet was used to match probe sets between platforms used for SCG and DRG hybridizations. Due to redundancies in the older array design, multiple probe sets on the U74v2 arrays have the same best match in the 430A design. For these cases, the Affymetrix probe descriptions were used to determine a single best match, by selecting if possible the probeset match without any annotation qualifier, followed in decreasing preference those with g, f, or s annotations. The final dataset included 11,268 probesets matched across platforms; these were used for all further analysis.
| | Sample_platform_id | GPL339
| | Sample_contact_name | Moriah,,Szpara
| | Sample_contact_email | mszpara@princeton.edu
| | Sample_contact_laboratory | Enquist
| | Sample_contact_department | Molecular Biology
| | Sample_contact_institute | Princeton University
| | Sample_contact_address | 301 Schultz
| | Sample_contact_city | Princeton
| | Sample_contact_state | NJ
| | Sample_contact_zip/postal_code | 08544
| | Sample_contact_country | USA
| | Sample_supplementary_file | ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM246nnn/GSM246019/suppl/GSM246019.CEL.gz
| | Sample_series_id | GSE9738
| | Sample_series_id | GSE9744
| | Sample_data_row_count | 11268
| | |
|
| |
| |
Make groups for comparisons |
(2 groups will be compared at a time) |
|
| Select GSMs and click on "Add groups" |
Enter the group name here: |
|
|
|
